Hmdb loader

Showing Protein Guanine nucleotide-binding protein G(I)/G(S)/G(O) subunit gamma-8 (HMDBP08412)

IdentificationBiological propertiesGene propertiesProtein propertiesExternal linksReferencesXMLShow 3 metabolites
Identification
HMDB Protein ID HMDBP08412
Secondary Accession Numbers
  • 14124
Name Guanine nucleotide-binding protein G(I)/G(S)/G(O) subunit gamma-8
Synonyms
  1. Gamma-9
Gene Name GNG8
Protein Type Unknown
Biological Properties
General Function Involved in signal transducer activity
Specific Function Guanine nucleotide-binding proteins (G proteins) are involved as a modulator or transducer in various transmembrane signaling systems. The beta and gamma chains are required for the GTPase activity, for replacement of GDP by GTP, and for G protein- effector interaction
Pathways Not Available
Reactions Not Available
GO Classification
Component
cell part
membrane part
extrinsic to membrane
extrinsic to plasma membrane
heterotrimeric g-protein complex
Function
molecular transducer activity
signal transducer activity
Process
signaling
signaling pathway
cell surface receptor linked signaling pathway
g-protein coupled receptor protein signaling pathway
Cellular Location
  1. Cell membrane
  2. Lipid-anchor
  3. Cytoplasmic side (Potential)
Gene Properties
Chromosome Location Chromosome:1
Locus 19q13.32
SNPs GNG8
Gene Sequence 
>213 bp
ATGTCCAACAACATGGCCAAGATTGCCGAGGCCCGCAAGACGGTGGAACAGCTGAAGCTG
GAGGTGAACATCGACCGCATGAAGGTGTCGCAGGCAGCAGCGGAACTCCTGGCTTTCTGC
GAGACGCATGCCAAAGATGACCCGCTGGTGACGCCAGTACCCGCCGCGGAGAACCCCTTC
CGCGACAAGCGCCTCTTTTGTGTTCTGCTCTGA
Protein Properties
Number of Residues 70
Molecular Weight 7841.1
Theoretical pI 7.27
Pfam Domain Function
Signals
  • None
Transmembrane Regions
  • None
Protein Sequence 
>Guanine nucleotide-binding protein G(I)/G(S)/G(O) subunit gamma-8
MSNNMAKIAEARKTVEQLKLEVNIDRMKVSQAAAELLAFCETHAKDDPLVTPVPAAENPF
RDKRLFCVLL
GenBank ID Protein 6164867
UniProtKB/Swiss-Prot ID Q9UK08
UniProtKB/Swiss-Prot Entry Name GBG8_HUMAN
PDB IDs Not Available
GenBank Gene ID AF188179
GeneCard ID GNG8
GenAtlas ID GNG8
HGNC ID HGNC:19664
References
General References
  1. Gerhard DS, Wagner L, Feingold EA, Shenmen CM, Grouse LH, Schuler G, Klein SL, Old S, Rasooly R, Good P, Guyer M, Peck AM, Derge JG, Lipman D, Collins FS, Jang W, Sherry S, Feolo M, Misquitta L, Lee E, Rotmistrovsky K, Greenhut SF, Schaefer CF, Buetow K, Bonner TI, Haussler D, Kent J, Kiekhaus M, Furey T, Brent M, Prange C, Schreiber K, Shapiro N, Bhat NK, Hopkins RF, Hsie F, Driscoll T, Soares MB, Casavant TL, Scheetz TE, Brown-stein MJ, Usdin TB, Toshiyuki S, Carninci P, Piao Y, Dudekula DB, Ko MS, Kawakami K, Suzuki Y, Sugano S, Gruber CE, Smith MR, Simmons B, Moore T, Waterman R, Johnson SL, Ruan Y, Wei CL, Mathavan S, Gunaratne PH, Wu J, Garcia AM, Hulyk SW, Fuh E, Yuan Y, Sneed A, Kowis C, Hodgson A, Muzny DM, McPherson J, Gibbs RA, Fahey J, Helton E, Ketteman M, Madan A, Rodrigues S, Sanchez A, Whiting M, Madari A, Young AC, Wetherby KD, Granite SJ, Kwong PN, Brinkley CP, Pearson RL, Bouffard GG, Blakesly RW, Green ED, Dickson MC, Rodriguez AC, Grimwood J, Schmutz J, Myers RM, Butterfield YS, Griffith M, Griffith OL, Krzywinski MI, Liao N, Morin R, Palmquist D, Petrescu AS, Skalska U, Smailus DE, Stott JM, Schnerch A, Schein JE, Jones SJ, Holt RA, Baross A, Marra MA, Clifton S, Makowski KA, Bosak S, Malek J: The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). Genome Res. 2004 Oct;14(10B):2121-7. [PubMed:15489334 ]
  2. Hurowitz EH, Melnyk JM, Chen YJ, Kouros-Mehr H, Simon MI, Shizuya H: Genomic characterization of the human heterotrimeric G protein alpha, beta, and gamma subunit genes. DNA Res. 2000 Apr 28;7(2):111-20. [PubMed:10819326 ]